In Gene analysis and Bio-engineering, different types of string manipulation are conducted to achieve new information. Finding Longest Common Sub-sequence (LCS) is a procedure to compare two string that is mostly used in DNA. DNA consists with four types of nucleoli acid, such as guanine (G), adenine (A), thymine(T), cytosine (C). To represent a DNA sequence, we use first letter of these nucleotide base. Thus, we can get a long sequence like:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCAC
 |
| DNA Sequence [From: wiki] |
LCS is used to compare two long DNA sequence and find longest common sequence. The procedure is described below:
মন্তব্যসমূহ
একটি মন্তব্য পোস্ট করুন